Mature sequence bra-miR171e

Accession numberMIMAT0010165
IDbra-miR171e
Stem-Loop bra-MIR171e
Sequence
ugauugagccgcgccaauauc
Get sequence
Deep sequencing reads, experiments

References

1
2