Mature sequence bra-miR171c

Accession numberMIMAT0010163
IDbra-miR171c
Stem-Loop bra-MIR171c
Sequence
uugagccgugccaauaucacg
Get sequence
Deep sequencing reads, experiments

References

1