Mature sequence bra-miR167d

Accession numberMIMAT0010160
IDbra-miR167d
Stem-Loop bra-MIR167d
Sequence
ugaagcugccagcaugaucua
Get sequence
Deep sequencing reads, experiments

References

1