Mature sequence bmo-miR-993a-3p

Accession numberMIMAT0010129
IDbmo-miR-993a-3p
Previous IDsbmo-miR-993a
Sequence
gaagcucgucucuacagguaucu
Get sequence
Stem-Loop bmo-mir-993a

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).