Mature sequence aga-miR-309

Accession numberMIMAT0010112
IDaga-miR-309
Stem-Loop aga-mir-309
Sequence
ucacugggcaaaguuugucgca
Get sequence
Deep sequencing reads, experiments

References

1
" Griffiths-Jones S Unpublished (2009).