Mature sequence aga-miR-1000

Accession numberMIMAT0010109
IDaga-miR-1000
Stem-Loop aga-mir-1000
Sequence
auauuguccugucacagcagu
Get sequence
Deep sequencing reads, experiments

References

1
" Griffiths-Jones S Unpublished (2009).