Mature sequence gma-miR2108b

Accession numberMIMAT0010085
IDgma-miR2108b
Stem-Loop gma-MIR2108b
Sequence
uuaauguguuguguuugugag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).