Mature sequence zma-miR396d

Accession numberMIMAT0010077
IDzma-miR396d
Stem-Loop zma-MIR396d
Sequence
uuccacaggcuuucuugaacug
Get sequence
Deep sequencing6292 reads, 193 experiments
Database links
QuickGO function

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).