Mature sequence osa-miR2105

Accession numberMIMAT0010073
IDosa-miR2105
Stem-Loop osa-MIR2105
Sequence
uugugaugugaaugauucau
Get sequence
Deep sequencing6 reads, 2 experiments

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).