Mature sequence osa-miR396f-5p

Accession numberMIMAT0010070
IDosa-miR396f-5p
Previous IDsosa-miR396f
Stem-Loop osa-MIR396f
Sequence
ucuccacaggcuuucuugaacu
Get sequence
Deep sequencing2131 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).