Mature sequence mtr-miR1509a-5p

Accession numberMIMAT0010034
IDmtr-miR1509a-5p
Previous IDsmtr-miR1509
Stem-Loop mtr-MIR1509a
Sequence
uuaaucuaggaaaauacggug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).