Mature sequence ppt-miR1023e-3p

Accession numberMIMAT0010025
IDppt-miR1023e-3p
Stem-Loop ppt-MIR1023e
Sequence
agggaaucggguggagugcau
Get sequence
Deep sequencing reads, experiments

References

1