Mature sequence ppt-miR2083-3p

Accession numberMIMAT0010023
IDppt-miR2083-3p
Stem-Loop ppt-MIR2083
Sequence
agauugacgagugcaagaaga
Get sequence
Deep sequencing reads, experiments

References

1