Mature sequence ppt-miR2083-5p

Accession numberMIMAT0010022
IDppt-miR2083-5p
Stem-Loop ppt-MIR2083
Sequence
uucuugcacuccuccaucucu
Get sequence
Deep sequencing reads, experiments

References

1