Mature sequence ppt-miR2082

Accession numberMIMAT0010021
IDppt-miR2082
Stem-Loop ppt-MIR2082
Sequence
uguguguuccgcuucuucuuu
Get sequence
Deep sequencing reads, experiments

References

1