Mature sequence ppt-miR2081

Accession numberMIMAT0010020
IDppt-miR2081
Stem-Loop ppt-MIR2081
Sequence
agcuagaguuaugugucugau
Get sequence
Deep sequencing reads, experiments

References

1