Mature sequence ppt-miR2085

Accession numberMIMAT0010019
IDppt-miR2085
Stem-Loop ppt-MIR2085
Sequence
acaauccaacaaugcaggcgc
Get sequence
Deep sequencing reads, experiments

References

1