Mature sequence ppt-miR2084

Accession numberMIMAT0010018
IDppt-miR2084
Stem-Loop ppt-MIR2084
Sequence
ccugcauuguuggauugugga
Get sequence
Deep sequencing reads, experiments

References

1