Mature sequence ppt-miR2080

Accession numberMIMAT0010017
IDppt-miR2080
Stem-Loop ppt-MIR2080
Sequence
uccauaucaauucgcagaugc
Get sequence
Deep sequencing reads, experiments

References

1