Mature sequence ppt-miR2079

Accession numberMIMAT0010016
IDppt-miR2079
Stem-Loop ppt-MIR2079
Sequence
agaguugauguugaugacgca
Get sequence
Deep sequencing reads, experiments

References

1