Mature sequence ppt-miR2078

Accession numberMIMAT0010015
IDppt-miR2078
Stem-Loop ppt-MIR2078
Sequence
gguuggcuugccugugccugu
Get sequence
Deep sequencing reads, experiments

References

1