Mature sequence ppt-miR2077

Accession numberMIMAT0010014
IDppt-miR2077
Stem-Loop ppt-MIR2077
Sequence
ucauaaacacgccauauuucc
Get sequence
Deep sequencing reads, experiments

References

1