Mature sequence bfl-miR-135a

Accession numberMIMAT0009992
IDbfl-miR-135a
Stem-Loop bfl-mir-135a-1 bfl-mir-135a-2
Sequence
uauggcuuucauccuaugugaa
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).