Mature sequence osa-miR827

Accession numberMIMAT0009981
IDosa-miR827
Stem-Loop osa-MIR827
Sequence
uuagaugaccaucagcaaaca
Get sequence
Deep sequencing722 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).