Mature sequence hsa-miR-2053

Accession numberMIMAT0009978
IDhsa-miR-2053
Stem-Loop hsa-mir-2053
Sequence
guguuaauuaaaccucuauuuac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18952845 "Prediction of human miRNAs using tissue-selective motifs in 3' UTRs" Chang YM, Juan HF, Lee TY, Chang YY, Yeh YM, Li WH, Shih AC Proc Natl Acad Sci U S A. 105:17061-17066(2008).