Mature sequence bta-miR-1224

Accession numberMIMAT0009944
IDbta-miR-1224
Stem-Loop bta-mir-1224
Sequence
gugaggacucgggagguggag
Get sequence
Deep sequencing150 reads, 47 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).