Mature sequence cfa-miR-96

Accession numberMIMAT0009861
IDcfa-miR-96
Stem-Loop cfa-mir-96
Sequence
uuuggcacuagcacauuuuugcu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).