Mature sequence aqu-miR-2021-5p

Accession numberMIMAT0009753
IDaqu-miR-2021-5p
Previous IDsaqu-miR-2021*
Stem-Loop aqu-mir-2021
Sequence
cauggaauaucggcacccauc
Get sequence
Deep sequencing69 reads, 7 experiments

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).