Mature sequence spu-miR-219-5p

Accession numberMIMAT0009685
IDspu-miR-219-5p
Previous IDsspu-miR-219
Stem-Loop spu-mir-219
Sequence
ugauuguccgaacgcaauucuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2