Mature sequence spu-miR-183

Accession numberMIMAT0009684
IDspu-miR-183
Stem-Loop spu-mir-183
Sequence
uauggcacuauagaauucacug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).