Mature sequence sko-miR-124-5p

Accession numberMIMAT0009624
IDsko-miR-124-5p
Previous IDssko-miR-124*
Stem-Loop sko-mir-124
Sequence
aguguucacagcgguccuugau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).