Mature sequence lgi-miR-9-3p

Accession numberMIMAT0009572
IDlgi-miR-9-3p
Previous IDslgi-miR-79
Stem-Loop lgi-mir-9 lgi-mir-79
Sequence
auaaagcuagguuaccaaaggc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).