Mature sequence cte-miR-219

Accession numberMIMAT0009556
IDcte-miR-219
Previous IDscap-miR-219
Stem-Loop cte-mir-219
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).