Mature sequence cte-miR-210a

Accession numberMIMAT0009534
IDcte-miR-210a
Previous IDscap-miR-210;cte-miR-210
Stem-Loop cte-mir-210a
Sequence
uuugugcgugugacagugacaau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).