Mature sequence bfl-miR-34a

Accession numberMIMAT0009475
IDbfl-miR-34a
Previous IDsbfl-miR-34
Stem-Loop bfl-mir-34a
Sequence
uggcaguguggauagcuggccguuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).