Mature sequence hsa-miR-1972

Accession numberMIMAT0009447
IDhsa-miR-1972
Stem-Loop hsa-mir-1972-1 hsa-mir-1972-2
Sequence
ucaggccaggcacaguggcuca
Get sequence
Deep sequencing1354 reads, 121 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18923441 "Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia" Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML Leukemia. 23:313-322(2009).