Mature sequence mmu-miR-1960

Accession numberMIMAT0009433
IDmmu-miR-1960
Stem-Loop mmu-mir-1960
Sequence
ccagugcuguuagaagagggcu
Get sequence
Deep sequencing1536 reads, 67 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).