Mature sequence ptr-miR-219-5p

Accession numberMIMAT0009193
IDptr-miR-219-5p
Stem-Loop ptr-mir-219-1 ptr-mir-219-2
Sequence
ugauuguccaaacgcaauucu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).