Mature sequence oan-miR-29a-2-5p

Accession numberMIMAT0009167
IDoan-miR-29a-2-5p
Previous IDsoan-miR-29a-2*
Stem-Loop oan-mir-29a-2
Sequence
ugaccgauuucucuugguguu
Get sequence
Deep sequencing386 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).