Mature sequence osa-miR1846c-3p

Accession numberMIMAT0009166
IDosa-miR1846c-3p
Stem-Loop osa-MIR1846c
Sequence
ugaccccggucugcucgcugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).