Mature sequence bmo-miR-9b-5p

Accession numberMIMAT0009161
IDbmo-miR-9b-5p
Previous IDsbmo-miR-9b
Sequence
gcuuugguaaucuagcuuuauga
Get sequence
Stem-Loop bmo-mir-9b

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).