Mature sequence bmo-miR-932

Accession numberMIMAT0009160
IDbmo-miR-932
Stem-Loop bmo-mir-932
Sequence
ucaauuccguagugcauugcag
Get sequence
Deep sequencing2 reads, 2 experiments

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).