Mature sequence bmo-miR-929-5p

Accession numberMIMAT0009158
IDbmo-miR-929-5p
Previous IDsbmo-miR-929
Sequence
auugacucuaguagggagucc
Get sequence
Stem-Loop bmo-mir-929

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).