Mature sequence bmo-miR-927-5p

Accession numberMIMAT0009157
IDbmo-miR-927-5p
Previous IDsbmo-miR-927
Sequence
uuuagaauuccuacgcuuuacc
Get sequence
Stem-Loop bmo-mir-927

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).