Mature sequence bmo-miR-92b

Accession numberMIMAT0009155
IDbmo-miR-92b
Previous IDsbmo-miR-92
Stem-Loop bmo-mir-92b
Sequence
aauugcaccaaucccggccugc
Get sequence
Deep sequencing14 reads, 3 experiments

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).