Mature sequence dsi-miR-309

Accession numberMIMAT0008894
IDdsi-miR-309
Stem-Loop dsi-mir-309
Sequence
gcacuggguaaaguuuguccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).