Mature sequence dmo-miR-5

Accession numberMIMAT0008691
IDdmo-miR-5
Stem-Loop dmo-mir-5
Sequence
aaaggaacgaucguugugauaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).