Mature sequence dan-miR-316

Accession numberMIMAT0008449
IDdan-miR-316
Stem-Loop dan-mir-316
Sequence
ugucuuuuuccgcuuacuggcg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).