Mature sequence tca-miR-2-3p

Accession numberMIMAT0008353
IDtca-miR-2-3p
Previous IDstca-miR-2
Stem-Loop tca-mir-2-3 tca-mir-2-1 tca-mir-2-2
Sequence
uaucacagccagcuuugaugagc
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).