Mature sequence ptr-miR-550

Accession numberMIMAT0008230
IDptr-miR-550
Stem-Loop ptr-mir-550-1 ptr-mir-550-2 ptr-mir-550-3
Sequence
agugccugagggaguaagagccc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).